3dsnp v2.0 API

3dsnp v2 for developers

3DSNP v2 extends the API functions of the previous version. The domain was changed and more importantly, SV data and some new tables were included. Now data can be accessed by three means: SNP ids, SV ids or Chromatin position.

We recommend using positions to search for variants which will display both SNPs and SVs in the target region.

We marked new features with *

Note: The original API are always open.

Overview

URL

https://omic.tech/3dsnpv2/api.do

Format supported

JSON/XML

HTTP request method

GET/POST

Login required

No

Data access restrictions

Frequency limit: No

Request

Request parameters

Required Type Information
id*/position true string Represents the SNP/SV ID or genomic position, at least one of them is required,
multiple SNP IDs or positions should separated by comma ‘,’.
Dash symbol ‘-‘
The format of parameter ‘position’
should be ‘1000000-1000100’. SV IDs could be found in HGSVC v2.
chrom false string Represents the chromosome of queried position and is required when parameter ‘position’ is used.
When there are more than one positions, the corresponding chromosomes should also be separated by ‘,’.
type true string Data type for searching, multiple types should be separated by comma ‘,’.
Available types are listed below.
format true string Represents data types returns. Json and XML formats are supported.

Request data type

DataType Description
basic Basic information of SNP, including sequential facts and phenotype from 1000G project.
chromhmm Chromatin state information generated by the core 15-state ChromHMM models trained
across a variety of cell types.
motif Transcription factor binding motifs altered by SNP.
tfbs Transcription factor binding sites in a variety of cell types.
eqtl Expression quantitative trait loci (eQTL).
3dgene Genes that interact the query SNP through chromatin loops.
3dsnp SNPs that interact the query SNP through chromatin loops. Not available for the query of position.
phylop PhyloP scores of genomic region surrounding the query SNP.
ccre* The status of open chromatin for over 750,000 candidate cis-regulatory elements (cCREs) in 54 distinct cell types.
genetics* Integrated haplotype scores (iHS) and Fixation index (Fst) for five continental population obtained from 1000 Genomes Phase 3 (final phase)
clinvar* ClinVar aggregates information about genomic variation and its relationship to human health.

Response

Response parameters

Type DataType Description
id string basic SNP ID
chr string basic Chromosome name
position string basic Location of the query
MAF string basic Minor allele frequency
Ref string basic Reference Allele
Alt string basic Alternative Allele
EAS string basic Allele frequency in the EAS populations
AMR string basic Allele frequency in the AMR populations
AFR string basic Allele frequency in the AFR populations
EUR string basic Allele frequency in the EUR populations
SAS string basic Allele frequency in the SAS populations
linearClosestGene string basic Linear cloest genes
data_gene JsonArray basic listed below in JsonArray Parameters
chromhmm string chromhmm Chromatin state from ChromHMM core 15-state model
data_chromhmm JsonArray chromhmm listed below in JsonArray Parameters
motif string motif Sequence motif altered by the query SNP
data_motif JsonArray motif listed below in JsonArray Parameters
tfbs string tfbs Transcription factor binding sites the query locates
data_tfbs JsonArray tfbs listed below in JsonArray Parameters
eqtl string eqtl Expression quantitative trait loci
data_eqtl JsonArray eqtl listed below in JsonArray Parameters
data_loop_gene JsonArray 3dgene listed below in JsonArray Parameters
data_loop_snp JsonArray 3dsnp listed below in JsonArray Parameters
physcores string physcores PhyloP scores of the query SNP and its +/-10 bp adjacent regions
ccre.position* string ccre The corresponding peak position of cCREs
mapping* string ccre Mapping rate of cCREs
Fol/Acn/Skm1/…/Swn_2* string ccre cCREs in 54 distinct cell types
Fst_EUR* string genetics Fixation index in EUR
Fst_SAS* string genetics Fixation index in SAS
Fst_EAS* string genetics Fixation index in EAS
Fst_AMR* string genetics Fixation index in AMR
Fst_AFR* string genetics Fixation index in AFR
iHS_EUR* string genetics Integrate Haplotype score in EUR
iHS_SAS* string genetics Integrate Haplotype score in SAS
iHS_EAS* string genetics Integrate Haplotype score in EAS
iHS_AMR* string genetics Integrate Haplotype score in AMR
iHS_AFR* string genetics Integrate Haplotype score in AFR
xpnsl_EUR* string genetics cross-population NSL in EUR
xpnsl_SAS* string genetics cross-population NSL in SAS
xpnsl_EAS* string genetics cross-population NSL in EAS
xpnsl_AMR* string genetics cross-population NSL in AMR
xpnsl_AFR* string genetics cross-population NSL in AFR
ClinVarID* string clinvar the ClinVar Allele ID
CLNDN* string clinvar ClinVar’s preferred disease name for the concept specified by disease identifiers in CLNDISDB
CLNDISDB* string clinvar Tag-value pairs of disease database name and identifier
CLNREVSTAT* string clinvar ClinVar review status for the Variation ID
CLNSIG* string clinvar Clinical significance for this single variant
CLNSIGCONF* string clinvar Conflicting clinical significance for this single variant
CLNVC* string clinvar Variant type
CLNVCSO* string clinvar Sequence Ontology id for variant type
CLNVI* string clinvar the variant’s clinical sources reported as tag-value pairs of database and variant identifier
GENEINFO* string clinvar Gene(s) for the variant reported as gene symbol:gene id
MC* string clinvar comma separated list of molecular consequence in the form of Sequence Ontology ID|molecular_consequence
ORIGIN* string clinvar Allele origin

JsonArray Parameters

Type JsonArray Description
geneID string data_gene RefSeq Gene ID
geneName string data_gene Official gene symbol
geneRelativePosition string data_gene Relative position of the closest gene to the query
geneDescription string data_gene Gene description
chromhmmCell string data_chromhmm Cell type of the corresponding chromatin state
chromhmmName string data_chromhmm Short name of chromatin state
chromhmmFullName string data_chromhmm Full name of chromatin state
chromhmmCellDescription string data_chromhmm Cell type description
chromhmmTissue string data_chromhmm Tissue of the cell type
motif string data_motif Motif ID in TRANSFAC or JASPAR
motifStrand string data_motif Strand of the motif
motifSource string data_motif Database source of the motif
motifMatchedSequence string data_motif Matched sequence for the motif
motifMatchedSequencePos string data_motif Relative position of the query to the sequence
motifRef string data_motif Reference allele
motifAlt string data_motif Alternative allel
tfbsCell string data_tfbs Cell type of the corresponding TFBS
tfbsFactor string data_tfbs Name of the transcription factor
tfbsCellTissue string data_tfbs Tissue of the cell type
tfbsDNAAccessibility string data_tfbs DNA accessibility of the TFBS
tfbsCellDescription string data_tfbs Description for the cell type
eqtlGene string data_eqtl Related gene of the eQTL
eqtlPValue string data_eqtl P-value of the eQTL
eqtlTissue string data_eqtl Tissue in which the eQTL identified
eqtlEffect string data_eqtl Effect size of the eQTL
loopGene string data_loop_gene Genes interacting the query SNP through chromatin loops
loopGeneID string data_loop_gene RefSeq Gene ID
loopGeneDescription string data_loop_gene Gene description
loopCell string data_loop_gene/data_loop_snp Cell type in which the chromatin loop was identified
loopCellTissue string data_loop_gene/data_loop_snp Tissue of the cell type
loopCellDescription string data_loop_gene/data_loop_snp Cell type description
loopStart string data_loop_gene/data_loop_snp Start genomic position of the chromatin loop
loopEnd string data_loop_gene/data_loop_snp End genomic position of the chromatin loop
loopType string data_loop_gene/data_loop_snp Type of the chromatin loop: “Within Loop” or “Anchor-to-Anchor”
loopSNP string data_loop_snp SNPs interacting with the query and in the same LD block through chromatin loops
loopLD string data_loop_snp r^2 in LD
loopPopulation string data_loop_snp Continental population (AFR, AMR, ASN, EUR and SAS)

Request with position

URL example1 : single position and single data type in json format

Request URL :

https://www.omic.tech/3dsnpv2/api.do?position=1000000-1100000&chrom=chr11&format=json&type=basic

Response format :

[
    {
        "id":"chr11-1009478-INS-50",
        "position":"1009477",
        "chrom":"chr11",
        "AFR":"0",
        "AMR":"0",
        "Alt":"AACACGCAGCCCATGACCCCGCGCCAGGGTCTGGAGGGACGGCCCCGGGGG",
        "EAS":"0",
        "EUR":"0",
        "Ref":"A",
        "SAS":"0",
        "MAF":"INS,0.000000",
        "linearClosestGene":""
    },
    {
        "id":"rs544411125",
        "position":"1000017",
        "chrom":"chr11",
        "AFR":"0",
        "AMR":"0",
        "Alt":"A",
        "EAS":"0",
        "EUR":"0",
        "Ref":"G",
        "SAS":"0.001",
        "MAF":"A,0.000199681",
        "linearClosestGene":"AP2A2,161,intron-variant",
        "data_gene":[
            {
            "geneID":"161",
            "geneName":"AP2A2",
            "geneRelativePosition":"intron-variant",
            "geneDescription":"adaptor related protein complex 2 alpha 2 subunit"
            }]
        }
]

URL example2 : single position and mutilple data types in xml format

Request URL :

https://www.omic.tech/3dsnpv2/api.do?position=100000-1000100&chrom=chr1&format=xml&type=eqtl,motif

Response format :

<a>
    <e class="object">
        <chrom type="string">chr1</chrom>
        <eqtl type="string"/>
        <id type="string">chr1-121118-INS-113</id>
        <motif type="string"/>
        <position type="string">121117</position>
    </e>
    <e class="object">
        <chrom type="string">chr1</chrom>
        <id type="string">chr1-126241-DEL-38630</id>
        <position type="string">126241</position>
        <data_motif class="array">
            <e class="object">
                <motif type="string">CEBPB_02</motif>
                <motifAlt type="string">DEL</motifAlt>
                <motifMatchedSequence type="string">TGATTGCACCACTG</motifMatchedSequence>
                <motifMatchedSequencePos type="string">16992</motifMatchedSequencePos>
                <motifRef type="string">.</motifRef>
                <motifSource type="string">Transfac</motifSource>
                <motifStrand type="string">-</motifStrand>
            </e>
            <e class="object">
                <motif type="string">ETS1_B</motif>
                <motifAlt type="string">DEL</motifAlt>
                <motifMatchedSequence type="string">GCAGGAAGTCAGGGA</motifMatchedSequence>
                <motifMatchedSequencePos type="string">-27799</motifMatchedSequencePos>
                <motifRef type="string">.</motifRef>
                <motifSource type="string">Transfac</motifSource>
                <motifStrand type="string">+</motifStrand>
            </e>
        </data_motif>
        <eqtl type="string"/>
        <motif type="string">Transfac,CEBPB_02,-,TGATTGCACCACTG,16992;Transfac,ETS1_B,+,GCAGGAAGTCAGGGA,-27799;Transfac,CEBPB_01,+,GGGTGAGGCAAGGG,-10490;Transfac,EBF_Q6,-,TTCCCTTGAGA,32414;Transfac,KROX_Q6,-,CTCGCCCCCTCCTC,4826;Transfac,CEBP_Q2_01,+,GTTGCCCAAGCT,-24111;Transfac,MTF1_Q4,-,ACTGCGCCCAGCCT,37618;Jaspar,SPI-1,-,CGGAAG,3705;Transfac,MYOD_Q6_01,-,TTGAAGCAGGTGATGGAG,24991;Transfac,TEL2_Q6,-,CCACTTCCTG,32686;Transfac,CRX_Q4,+,CCCGTAATCCCAG,-27209;Transfac,R_01,-,TGGGCCACCGGATGTGGTCCT,5445;Transfac,HNF4_01,-,ACGCGGACAGAGGTCAGCG,10966;Transfac,PAX4_01,+,GGAGGTGACCCGTGGGCAGCC,-6023;Transfac,PAX4_02,+,GAATAATTGCC,-1320;Transfac,PAX4_03,-,AGCCCCCACCCC,8402;Transfac,PAX4_04,+,AAAAATTAGCCGGGTGTGGTGGCACACACC,-3883;Transfac,IK3_01,+,TACTGGGAATGTC,-16898;Jaspar,SAP-1,-,ACCGGATGT,5439;Transfac,E2F1_Q4,+,CTTGGCGG,-33552;Transfac,HNF1_Q6,-,AGGTTAATAATTATCTCT,35228;Transfac,E2F1_Q3,+,CGTGGCGC,-28392;Transfac,AR_02,-,CGCCCACGATCAACGTGTTCTGTTCTG,8539;Transfac,ETF_Q6,+,GCGGCGG,-11412;Transfac,EN1_01,-,GTAGTGG,3310;Transfac,SREBP_Q3,-,CCCATCACCCCA,17405;Transfac,AP4_01,-,AGGATCACCTGAGGTCAG,3413;Transfac,HAND1E47_01,+,GGTGGTGTCTGGCACT,-5938;Transfac,E2F1_Q3_01,-,TGGGCGGCAGCAGGGC,6056;Transfac,STAT3_01,-,GGTGATTTCCAGGATGTGAGC,17822;Transfac,MYB_Q3,+,GGTGCCAGTTG,-7224;Transfac,HMEF2_Q6,-,GGCTAAAACTACCCCT,35670;Transfac,EGR2_01,-,TCACGTGGGCGG,6061;Transfac,E2F_Q2,-,GGCGCG,6794;Transfac,PAX8_01,-,CGGTGTCGAGTGAGG,13827;Transfac,RP58_01,-,AACACATCTGGA,37199;Transfac,CEBPGAMMA_Q6,-,CCCACTTCAGAGA,19517;Transfac,HEN1_01,+,TCGGTGCTCAGCTGAGTCTGCA,-2833;Transfac,E2_Q6_01,-,CCCACCGTCTCTGGTT,19989;Transfac,HEN1_02,-,CCTGGGCCCAGCTCCGTCCTCT,9184;Transfac,USF2_Q6,+,CACGCG,-11114;Transfac,SP1_Q6,+,CAAGGGCGGGGCC,-11202;Transfac,SMAD4_Q6,+,AGGATGCAGCCAGCT,-33630;Transfac,CIZ_01,+,GAAAAAGCC,-12404;Transfac,TAL1ALPHAE47_01,-,TTGGCCAGATGGGGTC,14330;Jaspar,deltaEF1,+,CACCTG,-3326;Transfac,POLY_C,-,GAGAAAACCCTCCTGCTG,8438;Jaspar,ARNT,+,CACGTG,-6055;Transfac,MEF3_B,-,TGCCCAGGTTTCA,28126;Transfac,GATA2_01,+,GGGGATGGGG,-6520;Transfac,GR_01,+,GCAGCATGGGCAGGATGTTCTGCACAC,-7429;Transfac,CEBP_C,+,AGTGTGAGGCAAGACCTG,-12861;Jaspar,NF-kappaB,-,GGGAATTTCC,28429;Transfac,EGR3_01,+,CAGCGTGGGAGG,-10034;Transfac,TANTIGEN_B,+,GGGAGGCCGAGGCAGGCAG,-3797;Transfac,SRF_C,-,GCCTTTTTTGGCCCA,12574;Transfac,E4F1_Q6,-,CCTACGTCAC,13357;Jaspar,PPARgamma,-,AGAGGTCAGCGTGACCCCCT,9983;Transfac,HSF_Q6,+,TCCCAGGAGTTTC,-20707;Transfac,EGR1_01,-,TCACGTGGGCGG,6061;Transfac,ETS_Q4,-,TTCCACTTCCTG,32688;Transfac,USF_C,+,CCACGTGA,-6054;Transfac,E2_01,+,GAACCAGAGACGGTGG,-19973;Transfac,AHRHIF_Q6,-,CGCGTGCGG,11119;Transfac,RFX1_02,+,CTGTAGCCTAAGCAACAG,-22798;Transfac,BARBIE_01,-,TTCAAAAGGTGAGGG,28660;Transfac,FXR_IR1_Q6,+,GGATGAATGTCCC,-28051;Transfac,HNF3ALPHA_Q6,-,TGTTTGTTTTG,4737;Transfac,STRA13_01,-,GCCTCACGTGACTC,7198;Transfac,AHR_Q5,+,GTGGCGTGTGC,-21067;Transfac,ZF5_01,-,GGGCGCGG,6795;Jaspar,p65,-,GGGAATTTCC,28429;Transfac,FREAC3_01,-,GGCATGTAAATAAAGA,23069;Transfac,ATATA_B,+,GTATATAAGC,-31222;Transfac,ACAAT_B,+,GATTGGTGG,-26027;Transfac,AP4_Q5,+,CTCAGCTGGC,-13970;Transfac,AP4_Q6,+,CTCAGCTGGC,-13970;Jaspar,Yin-Yang,-,GCCATC,3377;Transfac,ZTA_Q2,-,TCACAGTGACTCA,14023;Transfac,E12_Q6,+,GGCAGGTGCCA,-7403;Transfac,ELK1_02,+,GCTGCCGGAAGGGA,-8752;Transfac,MYC_Q2,+,CACGTGG,-10864;Transfac,LBP1_Q6,-,CAGCTGC,2984;Transfac,TFIII_Q6,+,AGAGGGAGG,-19953;Transfac,LMO2COM_02,+,CAGATAGGG,-43;Transfac,LMO2COM_01,-,CCCCAGGTGTTG,7655;Transfac,SMAD_Q6,-,AGACTCCCC,9856;Transfac,MAF_Q6,+,TGAGGGCAAGTTGGCA,-34778;Jaspar,cEBP,-,TGGCGCAACCTT,38390;Jaspar,c-REL,+,GGGGAATTCC,-23710;Transfac,MUSCLE_INI_B,-,TCCCCCCACCACCCCCTCCCA,30643;Transfac,AP4_Q6_01,+,GCCAGCTGT,-36895;Transfac,DR3_Q4,+,CATCCCCTTCCTGACCCCTCC,-4972;Transfac,STAT5A_04,-,CACTTCCG,16011;Transfac,ATF4_Q2,-,GCTGACGCCACG,4915;Transfac,SPZ1_01,-,GGTGGAGGGATGGGG,16533;Jaspar,TCF11-MafG,+,CATGAC,-3852;Transfac,PAX2_02,+,CACAAACCC,-23836;Transfac,LUN1_01,+,TCCCAGCTACTTGGGAG,-3918;Transfac,PAX2_01,-,CCCTGTCACTCAGGATGGA,20254;Transfac,MAZR_01,-,TGGGGAGGGGCAC,27106;Transfac,MYOGNF1_01,+,AATCCTTTCAGTTTGGGACGGAGTAAGGC,-7790;Transfac,HSF2_01,-,GGAAGCTTCG,13805;Transfac,T3R_01,+,CTGGGAGGTCACGGCT,-21588;Transfac,ZIC3_01,+,TGGGGGGTC,-13048;Transfac,ISRE_01,+,CAGTTTCTCTTCCTG,-29546;Jaspar,Bsap,+,TGGTCAACGCAGCAGAGCGG,-6478;Transfac,CDXA_02,+,ATTACTG,-16382;Transfac,CREB_Q4_01,+,CCGTGACGTAG,-13346;Transfac,ARNT_02,+,CGAGAGTCACGTGAGGCTGA,-7182;Transfac,HOGNESS_B,-,GTGGTGGCTCACGCCTGTAATCCCAGCACT,8124;Transfac,ARNT_01,-,CAGCTCACGTGGGCGG,6065;Transfac,HIF1_Q3,-,GCCCGCGTGCGGCC,11122;Transfac,LFA1_Q6,-,GGGGTCAG,7534;Transfac,GR_Q6,-,GGGCCTCGCTCTGTTGTCC,27466;Transfac,TEF1_Q6,+,GGAATG,-1360;Transfac,BACH1_01,-,GCTATGAGTCACCAC,1540;Transfac,TBP_Q6,+,TTTATAC,-8715;Transfac,E47_02,-,AATTACAGGTGTACGC,21546;Transfac,CP2_02,+,GCTGGGCTGAGCCAC,-6680;Transfac,E47_01,-,AGGGCAGGTGGCTCC,5145;Transfac,MEIS1_01,+,GAGTGACAGGGC,-20244;Transfac,PR_01,-,TGTTGAGGAGAATGCTGTTCTCATTGT,36718;Jaspar,MZF_1-4,+,TGGGGA,-2671;Transfac,OCT1_07,+,TTTATGGTAATT,-31767;Jaspar,Androgen,-,TTTGGCACAGCATGTACCTGTC,34465;Transfac,ZID_01,+,CAGCTCCATCACC,-24971;Jaspar,Pax6,+,TTCACGCTTTAGTT,-2658;Transfac,AREB6_02,+,ACACACCTGTAG,-3906;Transfac,AREB6_03,-,GTGCACCTGTAG,1658;Transfac,PAX_Q6,+,CTGGAAATCAC,-14033;Transfac,RREB1_01,+,CCCCAAAAAACCCT,-1014;Transfac,MEF2_01,-,GGCTAAAACTACCCCT,35670;Transfac,LPOLYA_B,+,CAATAAAG,-22981;Transfac,MEF2_03,-,TAGGTGCCTATAAATAGCATAG,31727;Transfac,ER_Q6,-,AGAGGTCAGCGTGACCCCC,9983;Transfac,MYB_Q6,-,CCCAACTGGC,7236;Transfac,PPARG_02,+,TTCCAGGTGAAGGTGGCCCACTT,-5598;Transfac,HFH4_01,-,TTATGTTTGTTTA,382;Transfac,HEB_Q6,-,GCCAGCTG,13979;Transfac,PPAR_DR1_Q2,+,TGACCTCTGTCCA,-10853;Transfac,OLF1_01,+,CAAGGTTCCCTAGAGAAATGGC,-35076;Transfac,MYOD_01,+,ACACAGGTGGTG,-5933;Transfac,CREBP1_Q2,-,GCTGACGCCACG,4915;Transfac,NERF_Q2,+,TTGCAGGAAGTCAGGGAC,-27797;Transfac,IRF_Q6,+,GTCAGTTTCTCTTCC,-29544;Transfac,XPF1_Q6,+,TCTGGGCAAC,-32109;Transfac,GEN_INI3_B,-,CCTCATTC,17236;Transfac,STAT6_02,+,GCCTTCCT,-7817;Transfac,AR_01,+,GGTACATGCTGTGCC,-34448;Transfac,NFKAPPAB_01,-,GGGAATTTCC,28429;Jaspar,HNF-1,-,GGTTAATAATTATC,35227;Transfac,EGR_Q6,+,GTGGGGGCAAG,-11163;Transfac,LYF1_01,+,TTTGGGAGG,-3584;Transfac,PPARA_01,-,CTGCCCCAGGCCAAATTTCT,12377;Transfac,PPARA_02,-,TGGGGTCAGGCAGGGCTGG,7535;Transfac,COUP_DR1_Q6,+,GGACCTTTGGCTT,-38525;Transfac,GATA1_02,-,TTCTAGATAGGGGC,21667;Transfac,VDR_Q3,-,GAGGGAATGGGGAGA,8449;Transfac,T3R_Q6,+,CCTGTCCTC,-6382;Transfac,VDR_Q6,+,CTGCCTGACCCC,-7523;Transfac,LXR_Q3,-,TGGGGTGACCCTGGTGCG,5511;Jaspar,FREAC-4,+,GTAAACAT,-20345;Transfac,LXR_DR4_Q3,+,TGACCGTCATTAAACC,-8569;Transfac,YY1_02,-,CCTGTGCCATCCAGGCTGGA,14512;Transfac,SP1_01,+,AGGGCGGGGC,-11204;Transfac,AP2_Q6_01,+,CGGCCCCCAGGCC,-4872;Transfac,TCF11_01,-,GTCATTCAGGACC,33780;Transfac,TAL1BETAE47_01,-,GGGGACAGATGGCAGT,25058;Transfac,PAX6_Q2,-,CTGACCTTGAACTC,20070;Transfac,SP3_Q3,-,AGCACTGTGGGAGG,2620;Transfac,SEF1_C,+,GGCCCCCAGGCCTGCGTTC,-4873;Transfac,NFKB_Q6_01,+,GACAAGGAAATTCCCG,-28415;Transfac,ZIC2_01,+,AGGGTGGTC,-27629;Transfac,AREB6_01,-,TACTCACCTGAGT,8388;Transfac,AP2_Q6,+,GGCCCCCAGGCC,-4873;Transfac,HNF4_DR1_Q3,+,TGACCTCTGTCCA,-10853;Transfac,NMYC_01,-,TCCCACGTGGAC,10872;Transfac,AP2_Q3,-,GCCCCCAGCCTTAGGC,22344;Transfac,MYOGENIN_Q6,+,GGCAGCTG,-5067;Transfac,CAP_01,-,TCAGCCCC,36304;Jaspar,c-ETS,+,CTTCCG,-3700;Jaspar,Staf,-,GGTTTCCCAGGGGGCAGTGC,14095;Jaspar,n-MYC,+,CACGTG,-6055;Jaspar,MEF2,+,CTATTTATAG,-31711;Transfac,PAX9_B,-,GTCACCCAGGGTGGAGTGCAGTGA,21178;Transfac,ER_Q6_02,+,GAGGTCACGGC,-21592;Jaspar,HLF,-,GGTTACACAATT,21743;Jaspar,GATA-3,+,AGATAG,-44;Transfac,MZF1_01,+,AGTGGGGA,-6218;Jaspar,Irf-1,-,GATAGTGAAACC,21815;Transfac,E2_Q6,+,GAACCAGAGACGGTGG,-19973;Transfac,SP1_Q6_01,+,AGGGCGGGGC,-11204;Transfac,CREB_Q2,+,CGTGACGTAGGG,-13347;Transfac,CREB_Q3,-,CGTCAG,778;Transfac,NFKB_C,-,AGGGATTTTCCT,20047;Transfac,CREB_Q4,+,CGTGACGTAGGG,-13347;Transfac,SREBP1_01,+,GATCACCTGAG,-4565;Jaspar,Ahr-ARNT,+,CGCGTG,-9987;Jaspar,SRF,-,GCCCATATATGA,37496;Transfac,DR4_Q2,-,CGGCCTCTCCAGACCCA,11714;Transfac,SP1_Q4_01,+,CAAGGGCGGGGCC,-11202;Transfac,TTF1_Q6,+,CCCCCAAGTGTG,-6842;Transfac,ATF_01,+,CCGTGACGTAGGGT,-13346;Transfac,HOXA3_01,+,CCTAATGGG,-35670;Transfac,POU6F1_01,+,GCATAATTTAT,-35917;Transfac,CREB_Q2_01,+,CTTGACGTCAGGAG,-38209;Transfac,GABP_B,-,CCGGGAAGAGCA,19270;Transfac,AHRARNT_01,+,GGAGGGTAGTGTGCCC,-27057;Transfac,DR1_Q3,-,TGGACAGAGGTCA,10865;Transfac,MZF1_02,-,TGGAGAGGGGCAA,19435;Transfac,P300_01,+,TCAAGGAGTGGGTG,-6194;Transfac,DELTAEF1_01,-,ACTCACCTGAG,8387;Jaspar,USF,+,CACGTGG,-10864;Transfac,CMYB_01,+,TACAAAGGCGGTTGGGAG,-11310;Transfac,PADS_C,-,TGTGGTCTC,4001;Jaspar,Chop-cEBP,-,GGGTGCAATGGC,21908;Transfac,DBP_Q6,+,AGCACAC,-6111;Transfac,NFKAPPAB65_01,-,GGGAATTTCC,28429;Transfac,AP2GAMMA_01,-,GCCTGGGGG,4883;Transfac,AHR_01,-,GCCCAGGCTGGAGTGCAA,18623;Transfac,TAL1BETAITF2_01,-,GGGGACAGATGGCAGT,25058;Transfac,PITX2_Q2,+,TGTAATCCCAA,-3780;Transfac,CAAT_C,+,GCCCAATAACCAGCTCCTCGCTGAT,-20432;Transfac,IK2_01,+,CTTTGGGAAGGC,-38457;Transfac,MIF1_01,+,TGGGTGCAGGGCCGCTGG,-7352;Transfac,IK1_01,+,GCTTGGGAAGGCC,-12009;Transfac,NFKB_Q6,+,ATGGGAATCTCCTC,-19067;Jaspar,Tal1beta-E47S,+,GGAACATCTGTT,-35130;Transfac,VJUN_01,+,GTGATGATGTCATTGC,-6140;Transfac,PAX5_02,+,GGAGTGCAATGTGAGCCGAGACCACACA,-3976;Transfac,PAX5_01,-,TCTTGGCTCACTGTAGTGTAGACTTCCC,18984;Transfac,BRACH_01,-,AGAATCACATGTAGGTGCCACAGT,16237;Transfac,CETS1P54_02,-,CCACCGGATGTGG,5441;Transfac,MAF_Q6_01,-,GGCTGAGTCAA,24942;Transfac,TAXCREB_02,+,GTGACCCACACCCTA,-28621;Jaspar,Pax-2,-,CGTCACGG,13353;Transfac,COMP1_01,+,TGTTATCAATGACAATGCGCGCCC,-28488;Transfac,CREL_01,+,GGGGAATTCC,-23710;Transfac,SP1_Q2_01,-,CCCCACCCCC,8399;Jaspar,c-MYB_1,+,GGCCGTTG,-11773;Transfac,SMAD3_Q6,-,TGTCTGTCT,16822;Transfac,E2A_Q6,+,CACCTGCC,-5136;Transfac,MYCMAX_03,+,CGAGAGTCACGTGAGGCTGA,-7182;Transfac,CHCH_01,+,CGGGGG,-6696;Transfac,E2A_Q2,-,GCACCTGCCTCAGT,7411;Transfac,BEL1_B,-,AAAGTGCTGAGATTACAGGCATAAGCCA,17103;Transfac,NRSE_B,+,CTCAGCACCTTGGCCAGCTCC,-24957;Transfac,MAZ_Q6,-,GGGGAGGG,16549;Transfac,ZIC1_01,+,TGGGGGGTC,-13048;Jaspar,RORalfa-1,+,TTCAAGGTCA,-20060;Transfac,NF1_Q6,+,TGCTGGCAGGCAGGCAGA,-12343;Transfac,MINI20_B,+,ACCTCCCACCATGGAGGAGGA,-5205;Transfac,VMW65_Q6,+,TCTCATTA,-25555;Transfac,NFKAPPAB50_01,+,GGGGAGTCCC,-5241;Jaspar,RREB-1,-,CCCCCCACCACCCCCTCCCA,30642;Jaspar,NRF-2,+,GCCGGAAGGG,-8755;Transfac,RFX1_01,+,TAGGCACCTAGTAACAG,-31718;Transfac,GNCF_01,+,CAGGAGTTCAAGGTCAGC,-20054;Jaspar,RXR-VDR,-,GGGTCACAGAGATCA,28627;Transfac,NRSF_01,+,CTCAGCACCTTGGCCAGCTCC,-24957;Transfac,USF_Q6_01,+,GCCCACGTGAGC,-6052;Transfac,P53_01,+,GGACATGGTGGCACATGTCT,-22689;Transfac,WHN_B,+,AGGGACGCCTT,-6534;Transfac,MINI19_B,-,GCAAGGAGCCACACAGCAGGA,13854;Transfac,GKLF_01,+,AAAGGAAGGAAGGG,-35999;Transfac,HNF4_01_B,+,GGGGGCAAAGGTAGG,-22339;Transfac,YY1_Q6,-,GCCATCTTG,18004;Jaspar,p53,-,CAGGACAAGTTCGAGCATCT,2978;Jaspar,p50,-,GGGGGTTCCCG,15798;Transfac,GATA2_02,-,GGAGATAAGA,33994;Transfac,GRE_C,+,GTCACACCCTGTCCTC,-6375;Transfac,FXR_Q3,+,CAAGGGCAGCAACC,-13934;Transfac,MYCMAX_B,-,GCCATGTGCC,30955;Transfac,NFE2_01,-,AGCTGAGGCAC,13976;Transfac,CACBINDINGPROTEIN_Q6,+,GGGGGTGGG,-8390;Transfac,MYOD_Q6,+,TGCACCTGTC,-6277;Transfac,STAF_02,+,ACATACCATCATGCCTGGCTA,-24189;Transfac,STAF_01,-,AGTTCCCGTAGTGCCTGACGGT,5931;Transfac,GATA3_02,-,GGAGATAAGA,33994;Jaspar,Myf,+,AGGCAGCAGGAG,-8418;Transfac,NRF2_01,+,GCCGGAAGGG,-8755;Transfac,GATA1_01,+,GGGGATGGGG,-6520;Transfac,ICSBP_Q6,+,GAAGAGAAACTG,-6711;Transfac,CETS1P54_01,-,ACCGGATGTG,5439;Transfac,TCF11MAFG_01,+,CTGTTGTGAGGCAGCAGTTGTG,-12574;Transfac,CACCCBINDINGFACTOR_Q6,+,AATCAGCTGGGTGTGG,-18121;Transfac,SMAD_Q6_01,+,TAGTCAGACAG,-34438;Transfac,GC_01,+,CAAGGGCGGGGCCT,-11202;Transfac,FOXM1_01,+,AGATGGAGT,-3171;Transfac,ARP1_01,-,TGAACTCCTGACCTCT,3835;Transfac,NGFIC_01,-,TCACGTGGGCGG,6061;Jaspar,Gklf,+,AAAGGGAAGG,-35981;Transfac,ERR1_Q2,+,AGTTCAAGGTCAGC,-20058;Jaspar,MZF_5-13,-,GGAGGGGGAG,8091</motif>
    </e>
</a>

Other examples could be found in the previous version.

Leave a Reply

Your email address will not be published. Required fields are marked *